|
Thermo Fisher
fluorescent stem loop rna dna oligonucleotide Fluorescent Stem Loop Rna Dna Oligonucleotide, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/fluorescent stem loop rna dna oligonucleotide/product/Thermo Fisher Average 99 stars, based on 1 article reviews
fluorescent stem loop rna dna oligonucleotide - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
|
Vazyme Biotech Co
stem‒loop reverse transcription Stem‒Loop Reverse Transcription, supplied by Vazyme Biotech Co, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/stem‒loop reverse transcription/product/Vazyme Biotech Co Average 96 stars, based on 1 article reviews
stem‒loop reverse transcription - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
|
Danaher Inc
stem loop rna sl7 ![]() Stem Loop Rna Sl7, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/stem loop rna sl7/product/Danaher Inc Average 86 stars, based on 1 article reviews
stem loop rna sl7 - by Bioz Stars,
2026-03
86/100 stars
|
Buy from Supplier |
|
Stonehouse Enterprises LLC
rna stem-loop complexed with the bacteriophage ms2 capsid ![]() Rna Stem Loop Complexed With The Bacteriophage Ms2 Capsid, supplied by Stonehouse Enterprises LLC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rna stem-loop complexed with the bacteriophage ms2 capsid/product/Stonehouse Enterprises LLC Average 90 stars, based on 1 article reviews
rna stem-loop complexed with the bacteriophage ms2 capsid - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Axolabs Inc
chemically synthesized rnas stem loop rnas mimicking the anticodon stem loop of trnaasp and trnatyr ![]() Chemically Synthesized Rnas Stem Loop Rnas Mimicking The Anticodon Stem Loop Of Trnaasp And Trnatyr, supplied by Axolabs Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/chemically synthesized rnas stem loop rnas mimicking the anticodon stem loop of trnaasp and trnatyr/product/Axolabs Inc Average 90 stars, based on 1 article reviews
chemically synthesized rnas stem loop rnas mimicking the anticodon stem loop of trnaasp and trnatyr - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Azenta
anticodon stem loop rna (32 nucleotides, /5-fam/uuggacuucuagugacgaauagagcaauucaa ![]() Anticodon Stem Loop Rna (32 Nucleotides, /5 Fam/Uuggacuucuagugacgaauagagcaauucaa, supplied by Azenta, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anticodon stem loop rna (32 nucleotides, /5-fam/uuggacuucuagugacgaauagagcaauucaa/product/Azenta Average 90 stars, based on 1 article reviews
anticodon stem loop rna (32 nucleotides, /5-fam/uuggacuucuagugacgaauagagcaauucaa - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Moderna
stem-loop d of the cloverleaf domain of enteroviral 50utr rna ![]() Stem Loop D Of The Cloverleaf Domain Of Enteroviral 50utr Rna, supplied by Moderna, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/stem-loop d of the cloverleaf domain of enteroviral 50utr rna/product/Moderna Average 90 stars, based on 1 article reviews
stem-loop d of the cloverleaf domain of enteroviral 50utr rna - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Danaher Inc
stem loop rna construct ![]() Stem Loop Rna Construct, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/stem loop rna construct/product/Danaher Inc Average 86 stars, based on 1 article reviews
stem loop rna construct - by Bioz Stars,
2026-03
86/100 stars
|
Buy from Supplier |
Journal: Nucleic Acids Research
Article Title: Assembly of SARS-CoV-2 nucleocapsid protein with nucleic acid
doi: 10.1093/nar/gkae256
Figure Lengend Snippet: Schematic organization of N-protein and hypothetical architectures of NA complexes. (A) Organization of N-protein chain with folded domains NTD (green cylinder) and CTD (blue square), and the intrinsically disordered N-arm, C-arm, and linker, the latter containing the transient helix in the leucine rich sequence (LRS) capable of oligomerization (cylinder). (B) N-protein in solution is a dimer linked with high affinity at the CTD. (C) Occupation of NA binding sites in the NTD induces folding in the LRS and causes compaction (magenta) and LRS oligomerization in dimers, trimers, tetramers, and higher oligomers. (D) Configuration of two N-protein dimers independently scaffolded on NA T40 (red bar) without further LRS oligomerization. (E) Two N-protein dimers scaffolded on NA and stabilized through LRS oligomerization. (F) Similar to (E) with crosslink between NA strands allowing the formation of higher oligomers. (G) N-protein dimer with two SL7 stem–loop RNA ({2N/2SL7}, grey), depicted in alternate configurations occupying all major NA interfaces in the NTD and CTD creating different intra-dimer crosslinks. (H) Possible architecture of N-protein/stem–loop complexes allowing {2N/2SL7} units to oligomerize via LRS and simultaneous multivalent binding of SL7 in inter-dimer crosslinks. Dotted lines belong to neighboring {2N/2SL7} units not fully drawn. (I) The top view of a 6x{2N/2SL7} hexamer of dimers. The dashed lines indicates two levels of inter-dimer crosslinks of neighboring {2N/2SL7} subunits, via contacts of the LRS interfaces (dark red dashed) and via multivalent RNA binding of CTD and/or scaffolding of NTD (light red dashed).
Article Snippet: The oligonucleotides T 40 , U 40 and
Techniques: Sequencing, Binding Assay, RNA Binding Assay, Scaffolding
Journal: Nucleic Acids Research
Article Title: Assembly of SARS-CoV-2 nucleocapsid protein with nucleic acid
doi: 10.1093/nar/gkae256
Figure Lengend Snippet: Complex mass distributions of NWT with T40, U40 and SL7 in mass photometry. Shown are mass histograms of NWT with T40 (A), U40 (B) and SL7 (C). The inset in (C) shows peak mass values vs peak number of the 0.25 μM NWT with 0.3 μM SL7 mixture and linear fit leading to a mass increment of 118 kDa.
Article Snippet: The oligonucleotides T 40 , U 40 and
Techniques:
Journal: Nucleic Acids Research
Article Title: Assembly of SARS-CoV-2 nucleocapsid protein with nucleic acid
doi: 10.1093/nar/gkae256
Figure Lengend Snippet: Concentration-dependent RNP assembly of NWT with stem–loop SL7. (A) Sedimentation coefficient distributions from SV-AUC experiments recorded at 260 nm. Mixtures of NWT and SL7 at concentrations indicated in B65K (or B75Na for the two most concentrated mixtures). (B) Autocorrelation data from DLS of the highest concentration mixture. The best-fit single-species model leads to a diffusion coefficient of 2.466 × 10−7 cm2/s or a Stokes radius of 8.5 nm.
Article Snippet: The oligonucleotides T 40 , U 40 and
Techniques: Concentration Assay, Sedimentation, Diffusion-based Assay
Journal: Nucleic Acids Research
Article Title: Assembly of SARS-CoV-2 nucleocapsid protein with nucleic acid
doi: 10.1093/nar/gkae256
Figure Lengend Snippet: RNP formation of N-protein with SL7 depends on LRS oligomerization in vitro and in viral assembly. (A) Mass distributions from MP of mixtures of 0.25 μM N-protein with 0.3 μM SL7 in moderate ionic strength buffer B65K for NWT and the mutants inhibiting LRS oligomerization N:L222P and N:L222P/R226P. (B) Sedimentation coefficient distributions from SV-AUC experiments at 2.5 μM N-protein with 3.0 μM SL7 in buffer B65K recorded at 260 nm. Shown are results with NWT, N:L222P and N:L222P/R226P.
Article Snippet: The oligonucleotides T 40 , U 40 and
Techniques: In Vitro, Sedimentation
Journal: Nucleic Acids Research
Article Title: Assembly of SARS-CoV-2 nucleocapsid protein with nucleic acid
doi: 10.1093/nar/gkae256
Figure Lengend Snippet: NTD and CTD binding to T40, U40 and SL7. Sedimentation coefficient distributions c(s) from SV-AUC of NTD (A) or CTD (B) alone and in mixtures with T40, U40 or SL7, respectively. Mixture experiments are carried out in low ionic strength buffer B10Na to promote formation of the complexes with maximum stoichiometry. Distributions of free NA are reduced by a factor 2. For NTD alone, the molecular weight determined from c(s) analysis and best-fit frictional ratio is 15.1 kDa, which compares well to the theoretically expected value of 15.2 kDa. For CTD alone, the experimental molecular weight is 27.3 kDa, which compares to the theoretical value of 26.6 kDa for a CTD dimer.
Article Snippet: The oligonucleotides T 40 , U 40 and
Techniques: Binding Assay, Sedimentation, Molecular Weight