Review





Similar Products

99
Thermo Fisher fluorescent stem loop rna dna oligonucleotide
Fluorescent Stem Loop Rna Dna Oligonucleotide, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fluorescent stem loop rna dna oligonucleotide/product/Thermo Fisher
Average 99 stars, based on 1 article reviews
fluorescent stem loop rna dna oligonucleotide - by Bioz Stars, 2026-03
99/100 stars
  Buy from Supplier

96
Vazyme Biotech Co stem‒loop reverse transcription
Stem‒Loop Reverse Transcription, supplied by Vazyme Biotech Co, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/stem‒loop reverse transcription/product/Vazyme Biotech Co
Average 96 stars, based on 1 article reviews
stem‒loop reverse transcription - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

86
Danaher Inc stem loop rna sl7
Schematic organization of N-protein and hypothetical architectures of NA complexes. (A) Organization of N-protein chain with folded domains NTD (green cylinder) and CTD (blue square), and the intrinsically disordered N-arm, C-arm, and linker, the latter containing the transient helix in the leucine rich sequence (LRS) capable of oligomerization (cylinder). (B) N-protein in solution is a dimer linked with high affinity at the CTD. (C) Occupation of NA binding sites in the NTD induces folding in the LRS and causes compaction (magenta) and LRS oligomerization in dimers, trimers, tetramers, and higher oligomers. (D) Configuration of two N-protein dimers independently scaffolded on NA T40 (red bar) without further LRS oligomerization. (E) Two N-protein dimers scaffolded on NA and stabilized through LRS oligomerization. (F) Similar to (E) with crosslink between NA strands allowing the formation of higher oligomers. (G) N-protein dimer with two <t>SL7</t> stem–loop <t>RNA</t> ({2N/2SL7}, grey), depicted in alternate configurations occupying all major NA interfaces in the NTD and CTD creating different intra-dimer crosslinks. (H) Possible architecture of N-protein/stem–loop complexes allowing {2N/2SL7} units to oligomerize via LRS and simultaneous multivalent binding of SL7 in inter-dimer crosslinks. Dotted lines belong to neighboring {2N/2SL7} units not fully drawn. (I) The top view of a 6x{2N/2SL7} hexamer of dimers. The dashed lines indicates two levels of inter-dimer crosslinks of neighboring {2N/2SL7} subunits, via contacts of the LRS interfaces (dark red dashed) and via multivalent RNA binding of CTD and/or scaffolding of NTD (light red dashed).
Stem Loop Rna Sl7, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/stem loop rna sl7/product/Danaher Inc
Average 86 stars, based on 1 article reviews
stem loop rna sl7 - by Bioz Stars, 2026-03
86/100 stars
  Buy from Supplier

90
Stonehouse Enterprises LLC rna stem-loop complexed with the bacteriophage ms2 capsid
Schematic organization of N-protein and hypothetical architectures of NA complexes. (A) Organization of N-protein chain with folded domains NTD (green cylinder) and CTD (blue square), and the intrinsically disordered N-arm, C-arm, and linker, the latter containing the transient helix in the leucine rich sequence (LRS) capable of oligomerization (cylinder). (B) N-protein in solution is a dimer linked with high affinity at the CTD. (C) Occupation of NA binding sites in the NTD induces folding in the LRS and causes compaction (magenta) and LRS oligomerization in dimers, trimers, tetramers, and higher oligomers. (D) Configuration of two N-protein dimers independently scaffolded on NA T40 (red bar) without further LRS oligomerization. (E) Two N-protein dimers scaffolded on NA and stabilized through LRS oligomerization. (F) Similar to (E) with crosslink between NA strands allowing the formation of higher oligomers. (G) N-protein dimer with two <t>SL7</t> stem–loop <t>RNA</t> ({2N/2SL7}, grey), depicted in alternate configurations occupying all major NA interfaces in the NTD and CTD creating different intra-dimer crosslinks. (H) Possible architecture of N-protein/stem–loop complexes allowing {2N/2SL7} units to oligomerize via LRS and simultaneous multivalent binding of SL7 in inter-dimer crosslinks. Dotted lines belong to neighboring {2N/2SL7} units not fully drawn. (I) The top view of a 6x{2N/2SL7} hexamer of dimers. The dashed lines indicates two levels of inter-dimer crosslinks of neighboring {2N/2SL7} subunits, via contacts of the LRS interfaces (dark red dashed) and via multivalent RNA binding of CTD and/or scaffolding of NTD (light red dashed).
Rna Stem Loop Complexed With The Bacteriophage Ms2 Capsid, supplied by Stonehouse Enterprises LLC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rna stem-loop complexed with the bacteriophage ms2 capsid/product/Stonehouse Enterprises LLC
Average 90 stars, based on 1 article reviews
rna stem-loop complexed with the bacteriophage ms2 capsid - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Axolabs Inc chemically synthesized rnas stem loop rnas mimicking the anticodon stem loop of trnaasp and trnatyr
Schematic organization of N-protein and hypothetical architectures of NA complexes. (A) Organization of N-protein chain with folded domains NTD (green cylinder) and CTD (blue square), and the intrinsically disordered N-arm, C-arm, and linker, the latter containing the transient helix in the leucine rich sequence (LRS) capable of oligomerization (cylinder). (B) N-protein in solution is a dimer linked with high affinity at the CTD. (C) Occupation of NA binding sites in the NTD induces folding in the LRS and causes compaction (magenta) and LRS oligomerization in dimers, trimers, tetramers, and higher oligomers. (D) Configuration of two N-protein dimers independently scaffolded on NA T40 (red bar) without further LRS oligomerization. (E) Two N-protein dimers scaffolded on NA and stabilized through LRS oligomerization. (F) Similar to (E) with crosslink between NA strands allowing the formation of higher oligomers. (G) N-protein dimer with two <t>SL7</t> stem–loop <t>RNA</t> ({2N/2SL7}, grey), depicted in alternate configurations occupying all major NA interfaces in the NTD and CTD creating different intra-dimer crosslinks. (H) Possible architecture of N-protein/stem–loop complexes allowing {2N/2SL7} units to oligomerize via LRS and simultaneous multivalent binding of SL7 in inter-dimer crosslinks. Dotted lines belong to neighboring {2N/2SL7} units not fully drawn. (I) The top view of a 6x{2N/2SL7} hexamer of dimers. The dashed lines indicates two levels of inter-dimer crosslinks of neighboring {2N/2SL7} subunits, via contacts of the LRS interfaces (dark red dashed) and via multivalent RNA binding of CTD and/or scaffolding of NTD (light red dashed).
Chemically Synthesized Rnas Stem Loop Rnas Mimicking The Anticodon Stem Loop Of Trnaasp And Trnatyr, supplied by Axolabs Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/chemically synthesized rnas stem loop rnas mimicking the anticodon stem loop of trnaasp and trnatyr/product/Axolabs Inc
Average 90 stars, based on 1 article reviews
chemically synthesized rnas stem loop rnas mimicking the anticodon stem loop of trnaasp and trnatyr - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Azenta anticodon stem loop rna (32 nucleotides, /5-fam/uuggacuucuagugacgaauagagcaauucaa
Schematic organization of N-protein and hypothetical architectures of NA complexes. (A) Organization of N-protein chain with folded domains NTD (green cylinder) and CTD (blue square), and the intrinsically disordered N-arm, C-arm, and linker, the latter containing the transient helix in the leucine rich sequence (LRS) capable of oligomerization (cylinder). (B) N-protein in solution is a dimer linked with high affinity at the CTD. (C) Occupation of NA binding sites in the NTD induces folding in the LRS and causes compaction (magenta) and LRS oligomerization in dimers, trimers, tetramers, and higher oligomers. (D) Configuration of two N-protein dimers independently scaffolded on NA T40 (red bar) without further LRS oligomerization. (E) Two N-protein dimers scaffolded on NA and stabilized through LRS oligomerization. (F) Similar to (E) with crosslink between NA strands allowing the formation of higher oligomers. (G) N-protein dimer with two <t>SL7</t> stem–loop <t>RNA</t> ({2N/2SL7}, grey), depicted in alternate configurations occupying all major NA interfaces in the NTD and CTD creating different intra-dimer crosslinks. (H) Possible architecture of N-protein/stem–loop complexes allowing {2N/2SL7} units to oligomerize via LRS and simultaneous multivalent binding of SL7 in inter-dimer crosslinks. Dotted lines belong to neighboring {2N/2SL7} units not fully drawn. (I) The top view of a 6x{2N/2SL7} hexamer of dimers. The dashed lines indicates two levels of inter-dimer crosslinks of neighboring {2N/2SL7} subunits, via contacts of the LRS interfaces (dark red dashed) and via multivalent RNA binding of CTD and/or scaffolding of NTD (light red dashed).
Anticodon Stem Loop Rna (32 Nucleotides, /5 Fam/Uuggacuucuagugacgaauagagcaauucaa, supplied by Azenta, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anticodon stem loop rna (32 nucleotides, /5-fam/uuggacuucuagugacgaauagagcaauucaa/product/Azenta
Average 90 stars, based on 1 article reviews
anticodon stem loop rna (32 nucleotides, /5-fam/uuggacuucuagugacgaauagagcaauucaa - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Moderna stem-loop d of the cloverleaf domain of enteroviral 50utr rna
Schematic organization of N-protein and hypothetical architectures of NA complexes. (A) Organization of N-protein chain with folded domains NTD (green cylinder) and CTD (blue square), and the intrinsically disordered N-arm, C-arm, and linker, the latter containing the transient helix in the leucine rich sequence (LRS) capable of oligomerization (cylinder). (B) N-protein in solution is a dimer linked with high affinity at the CTD. (C) Occupation of NA binding sites in the NTD induces folding in the LRS and causes compaction (magenta) and LRS oligomerization in dimers, trimers, tetramers, and higher oligomers. (D) Configuration of two N-protein dimers independently scaffolded on NA T40 (red bar) without further LRS oligomerization. (E) Two N-protein dimers scaffolded on NA and stabilized through LRS oligomerization. (F) Similar to (E) with crosslink between NA strands allowing the formation of higher oligomers. (G) N-protein dimer with two <t>SL7</t> stem–loop <t>RNA</t> ({2N/2SL7}, grey), depicted in alternate configurations occupying all major NA interfaces in the NTD and CTD creating different intra-dimer crosslinks. (H) Possible architecture of N-protein/stem–loop complexes allowing {2N/2SL7} units to oligomerize via LRS and simultaneous multivalent binding of SL7 in inter-dimer crosslinks. Dotted lines belong to neighboring {2N/2SL7} units not fully drawn. (I) The top view of a 6x{2N/2SL7} hexamer of dimers. The dashed lines indicates two levels of inter-dimer crosslinks of neighboring {2N/2SL7} subunits, via contacts of the LRS interfaces (dark red dashed) and via multivalent RNA binding of CTD and/or scaffolding of NTD (light red dashed).
Stem Loop D Of The Cloverleaf Domain Of Enteroviral 50utr Rna, supplied by Moderna, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/stem-loop d of the cloverleaf domain of enteroviral 50utr rna/product/Moderna
Average 90 stars, based on 1 article reviews
stem-loop d of the cloverleaf domain of enteroviral 50utr rna - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

86
Danaher Inc stem loop rna construct
Schematic organization of N-protein and hypothetical architectures of NA complexes. (A) Organization of N-protein chain with folded domains NTD (green cylinder) and CTD (blue square), and the intrinsically disordered N-arm, C-arm, and linker, the latter containing the transient helix in the leucine rich sequence (LRS) capable of oligomerization (cylinder). (B) N-protein in solution is a dimer linked with high affinity at the CTD. (C) Occupation of NA binding sites in the NTD induces folding in the LRS and causes compaction (magenta) and LRS oligomerization in dimers, trimers, tetramers, and higher oligomers. (D) Configuration of two N-protein dimers independently scaffolded on NA T40 (red bar) without further LRS oligomerization. (E) Two N-protein dimers scaffolded on NA and stabilized through LRS oligomerization. (F) Similar to (E) with crosslink between NA strands allowing the formation of higher oligomers. (G) N-protein dimer with two <t>SL7</t> stem–loop <t>RNA</t> ({2N/2SL7}, grey), depicted in alternate configurations occupying all major NA interfaces in the NTD and CTD creating different intra-dimer crosslinks. (H) Possible architecture of N-protein/stem–loop complexes allowing {2N/2SL7} units to oligomerize via LRS and simultaneous multivalent binding of SL7 in inter-dimer crosslinks. Dotted lines belong to neighboring {2N/2SL7} units not fully drawn. (I) The top view of a 6x{2N/2SL7} hexamer of dimers. The dashed lines indicates two levels of inter-dimer crosslinks of neighboring {2N/2SL7} subunits, via contacts of the LRS interfaces (dark red dashed) and via multivalent RNA binding of CTD and/or scaffolding of NTD (light red dashed).
Stem Loop Rna Construct, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/stem loop rna construct/product/Danaher Inc
Average 86 stars, based on 1 article reviews
stem loop rna construct - by Bioz Stars, 2026-03
86/100 stars
  Buy from Supplier

Image Search Results


Schematic organization of N-protein and hypothetical architectures of NA complexes. (A) Organization of N-protein chain with folded domains NTD (green cylinder) and CTD (blue square), and the intrinsically disordered N-arm, C-arm, and linker, the latter containing the transient helix in the leucine rich sequence (LRS) capable of oligomerization (cylinder). (B) N-protein in solution is a dimer linked with high affinity at the CTD. (C) Occupation of NA binding sites in the NTD induces folding in the LRS and causes compaction (magenta) and LRS oligomerization in dimers, trimers, tetramers, and higher oligomers. (D) Configuration of two N-protein dimers independently scaffolded on NA T40 (red bar) without further LRS oligomerization. (E) Two N-protein dimers scaffolded on NA and stabilized through LRS oligomerization. (F) Similar to (E) with crosslink between NA strands allowing the formation of higher oligomers. (G) N-protein dimer with two SL7 stem–loop RNA ({2N/2SL7}, grey), depicted in alternate configurations occupying all major NA interfaces in the NTD and CTD creating different intra-dimer crosslinks. (H) Possible architecture of N-protein/stem–loop complexes allowing {2N/2SL7} units to oligomerize via LRS and simultaneous multivalent binding of SL7 in inter-dimer crosslinks. Dotted lines belong to neighboring {2N/2SL7} units not fully drawn. (I) The top view of a 6x{2N/2SL7} hexamer of dimers. The dashed lines indicates two levels of inter-dimer crosslinks of neighboring {2N/2SL7} subunits, via contacts of the LRS interfaces (dark red dashed) and via multivalent RNA binding of CTD and/or scaffolding of NTD (light red dashed).

Journal: Nucleic Acids Research

Article Title: Assembly of SARS-CoV-2 nucleocapsid protein with nucleic acid

doi: 10.1093/nar/gkae256

Figure Lengend Snippet: Schematic organization of N-protein and hypothetical architectures of NA complexes. (A) Organization of N-protein chain with folded domains NTD (green cylinder) and CTD (blue square), and the intrinsically disordered N-arm, C-arm, and linker, the latter containing the transient helix in the leucine rich sequence (LRS) capable of oligomerization (cylinder). (B) N-protein in solution is a dimer linked with high affinity at the CTD. (C) Occupation of NA binding sites in the NTD induces folding in the LRS and causes compaction (magenta) and LRS oligomerization in dimers, trimers, tetramers, and higher oligomers. (D) Configuration of two N-protein dimers independently scaffolded on NA T40 (red bar) without further LRS oligomerization. (E) Two N-protein dimers scaffolded on NA and stabilized through LRS oligomerization. (F) Similar to (E) with crosslink between NA strands allowing the formation of higher oligomers. (G) N-protein dimer with two SL7 stem–loop RNA ({2N/2SL7}, grey), depicted in alternate configurations occupying all major NA interfaces in the NTD and CTD creating different intra-dimer crosslinks. (H) Possible architecture of N-protein/stem–loop complexes allowing {2N/2SL7} units to oligomerize via LRS and simultaneous multivalent binding of SL7 in inter-dimer crosslinks. Dotted lines belong to neighboring {2N/2SL7} units not fully drawn. (I) The top view of a 6x{2N/2SL7} hexamer of dimers. The dashed lines indicates two levels of inter-dimer crosslinks of neighboring {2N/2SL7} subunits, via contacts of the LRS interfaces (dark red dashed) and via multivalent RNA binding of CTD and/or scaffolding of NTD (light red dashed).

Article Snippet: The oligonucleotides T 40 , U 40 and stem–loop RNA SL7 were purchased from Integrated DNA Technologies (Skokie, IL) and purified by HPLC and lyophilized by the vendor.

Techniques: Sequencing, Binding Assay, RNA Binding Assay, Scaffolding

Complex mass distributions of NWT with T40, U40 and SL7 in mass photometry. Shown are mass histograms of NWT with T40 (A), U40 (B) and SL7 (C). The inset in (C) shows peak mass values vs peak number of the 0.25 μM NWT with 0.3 μM SL7 mixture and linear fit leading to a mass increment of 118 kDa.

Journal: Nucleic Acids Research

Article Title: Assembly of SARS-CoV-2 nucleocapsid protein with nucleic acid

doi: 10.1093/nar/gkae256

Figure Lengend Snippet: Complex mass distributions of NWT with T40, U40 and SL7 in mass photometry. Shown are mass histograms of NWT with T40 (A), U40 (B) and SL7 (C). The inset in (C) shows peak mass values vs peak number of the 0.25 μM NWT with 0.3 μM SL7 mixture and linear fit leading to a mass increment of 118 kDa.

Article Snippet: The oligonucleotides T 40 , U 40 and stem–loop RNA SL7 were purchased from Integrated DNA Technologies (Skokie, IL) and purified by HPLC and lyophilized by the vendor.

Techniques:

Concentration-dependent RNP assembly of NWT with stem–loop SL7. (A) Sedimentation coefficient distributions from SV-AUC experiments recorded at 260 nm. Mixtures of NWT and SL7 at concentrations indicated in B65K (or B75Na for the two most concentrated mixtures). (B) Autocorrelation data from DLS of the highest concentration mixture. The best-fit single-species model leads to a diffusion coefficient of 2.466 × 10−7 cm2/s or a Stokes radius of 8.5 nm.

Journal: Nucleic Acids Research

Article Title: Assembly of SARS-CoV-2 nucleocapsid protein with nucleic acid

doi: 10.1093/nar/gkae256

Figure Lengend Snippet: Concentration-dependent RNP assembly of NWT with stem–loop SL7. (A) Sedimentation coefficient distributions from SV-AUC experiments recorded at 260 nm. Mixtures of NWT and SL7 at concentrations indicated in B65K (or B75Na for the two most concentrated mixtures). (B) Autocorrelation data from DLS of the highest concentration mixture. The best-fit single-species model leads to a diffusion coefficient of 2.466 × 10−7 cm2/s or a Stokes radius of 8.5 nm.

Article Snippet: The oligonucleotides T 40 , U 40 and stem–loop RNA SL7 were purchased from Integrated DNA Technologies (Skokie, IL) and purified by HPLC and lyophilized by the vendor.

Techniques: Concentration Assay, Sedimentation, Diffusion-based Assay

RNP formation of N-protein with SL7 depends on LRS oligomerization in vitro and in viral assembly. (A) Mass distributions from MP of mixtures of 0.25 μM N-protein with 0.3 μM SL7 in moderate ionic strength buffer B65K for NWT and the mutants inhibiting LRS oligomerization N:L222P and N:L222P/R226P. (B) Sedimentation coefficient distributions from SV-AUC experiments at 2.5 μM N-protein with 3.0 μM SL7 in buffer B65K recorded at 260 nm. Shown are results with NWT, N:L222P and N:L222P/R226P.

Journal: Nucleic Acids Research

Article Title: Assembly of SARS-CoV-2 nucleocapsid protein with nucleic acid

doi: 10.1093/nar/gkae256

Figure Lengend Snippet: RNP formation of N-protein with SL7 depends on LRS oligomerization in vitro and in viral assembly. (A) Mass distributions from MP of mixtures of 0.25 μM N-protein with 0.3 μM SL7 in moderate ionic strength buffer B65K for NWT and the mutants inhibiting LRS oligomerization N:L222P and N:L222P/R226P. (B) Sedimentation coefficient distributions from SV-AUC experiments at 2.5 μM N-protein with 3.0 μM SL7 in buffer B65K recorded at 260 nm. Shown are results with NWT, N:L222P and N:L222P/R226P.

Article Snippet: The oligonucleotides T 40 , U 40 and stem–loop RNA SL7 were purchased from Integrated DNA Technologies (Skokie, IL) and purified by HPLC and lyophilized by the vendor.

Techniques: In Vitro, Sedimentation

NTD and CTD binding to T40, U40 and SL7. Sedimentation coefficient distributions c(s) from SV-AUC of NTD (A) or CTD (B) alone and in mixtures with T40, U40 or SL7, respectively. Mixture experiments are carried out in low ionic strength buffer B10Na to promote formation of the complexes with maximum stoichiometry. Distributions of free NA are reduced by a factor 2. For NTD alone, the molecular weight determined from c(s) analysis and best-fit frictional ratio is 15.1 kDa, which compares well to the theoretically expected value of 15.2 kDa. For CTD alone, the experimental molecular weight is 27.3 kDa, which compares to the theoretical value of 26.6 kDa for a CTD dimer.

Journal: Nucleic Acids Research

Article Title: Assembly of SARS-CoV-2 nucleocapsid protein with nucleic acid

doi: 10.1093/nar/gkae256

Figure Lengend Snippet: NTD and CTD binding to T40, U40 and SL7. Sedimentation coefficient distributions c(s) from SV-AUC of NTD (A) or CTD (B) alone and in mixtures with T40, U40 or SL7, respectively. Mixture experiments are carried out in low ionic strength buffer B10Na to promote formation of the complexes with maximum stoichiometry. Distributions of free NA are reduced by a factor 2. For NTD alone, the molecular weight determined from c(s) analysis and best-fit frictional ratio is 15.1 kDa, which compares well to the theoretically expected value of 15.2 kDa. For CTD alone, the experimental molecular weight is 27.3 kDa, which compares to the theoretical value of 26.6 kDa for a CTD dimer.

Article Snippet: The oligonucleotides T 40 , U 40 and stem–loop RNA SL7 were purchased from Integrated DNA Technologies (Skokie, IL) and purified by HPLC and lyophilized by the vendor.

Techniques: Binding Assay, Sedimentation, Molecular Weight